Update README.md

README.md

@@ -45,7 +45,7 @@ model = AutoModelForMaskedLM.from_pretrained("InstaDeepAI/nucleotide-transformer
 # Choose the length to which the input sequences are padded. By default, the 
 # model max length is chosen, but feel free to decrease it as the time taken to 
 # obtain the embeddings increases significantly with it.
-max_length = 15
+max_length = tokenizer.model_max_length
 
 # Create a dummy dna sequence and tokenize it
 sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]